Biology Forums » Genetics and Developmental Biology
5 FOLLOWERS
The Biology forum is the leading destination to discover, preserve and share your family history. This section is where you can talk about Genetics and Developmental Biology, learn about normal chromosomes, and ask Biology related questions to the experts.
Biology Forums » Genetics and Developmental Biology
5d ago
I’ve got these two images, not sure what they show. I’ve got an exam on them but we haven’t got the questions yet. Can anyone help with what it shows or any ideas on what the question could be?
Any help would be appreciated
Thank you in advance ..read more
Biology Forums » Genetics and Developmental Biology
2M ago
Hello!
I'm currently working on writing an essay from a competition with the following prompt:
"Many human diseases have a genetic component. Some diseases result from a change in a single gene or even multiple genes. Yet, many diseases are complex a ..read more
Biology Forums » Genetics and Developmental Biology
2M ago
Hi,
I am happy to share the news of my online, English-speaking course of "Foundational Knowledge in Bioinformatics". Looking forward to seeing you there. Applications can be submitted here: https://kedivim-apply.ihu.gr/en/node/220?
Best,
Spiros ..read more
Biology Forums » Genetics and Developmental Biology
4M ago
So there's a DNA sequence with a double stranded
DNA with a open reading frame encoding a small
polypeptide 5'
ATGGAGGAACCGCAGTCAGATCCTAGCTA GGTC3'
3' TACCTCCTTGGCGTCAGTCTAGGATCGAT CCAG 5'
So the mRNA transcribed from this DNA template
would be Since RNA ..read more
Biology Forums » Genetics and Developmental Biology
4M ago
I need help precisely answering the attachment below
Identify Homologous Chromosomes and Sister Chromatids in appropriate phases.
What are homologous chromosomes? Are they present in all cells? If not, which
cells lack homologous chromosomes? Are the ..read more
Biology Forums » Genetics and Developmental Biology
6M ago
Are all DNA damages and mutations random, or do they follow a predictable pattern with age ..read more
Biology Forums » Genetics and Developmental Biology
8M ago
How much do biologists know which DNA sequences would create a viable human being ..read more
Biology Forums » Genetics and Developmental Biology
9M ago
The original strain (wild type; WT) and two mutant strains of plant X are available, mutant A (mutA) and mutant B (mutB). Dr. Mishima started Experiment 2 with all three strains growing together in a flower bed. The seeds for all three strains are “tru ..read more
Biology Forums » Genetics and Developmental Biology
10M ago
1. Since the seedless bananas are triploid open parentheses 3 n close parentheses, and do not produce viable seeds for reproduction. To grow more seedless banana plants, farmers take a side shoot and replant it.
This type of reproduction is asexual rep ..read more
Biology Forums » Genetics and Developmental Biology
10M ago
Hello! But I just want to know the opinion of experts. Here, from one group in the social network on racial studies, I was told such a thing that if there is a relative (grandmother / grandfather or great-grandfather / great-grandmother) before the ..read more