Biology Online Forum » Genetics
5 FOLLOWERS
Learn everything and anything about Genetics in this category of the forum. Get analysis on Genetic diversity in plants population, share knowledge on visualization of DNA, and find help with the Punnett square & genotypic here.
Biology Online Forum » Genetics
1y ago
How can epigenetic modifications affect gene expression ..read more
Biology Online Forum » Genetics
1y ago
What is the role of epigenetics in the inheritance of genetic traits ..read more
Biology Online Forum » Genetics
1y ago
Hello everybody,
my apologies iam coming with maybe simple question, but i turning to you with ask for help to determine the proper method for analysis of plants population genetic diversity.
My quest is to map and describe genetic diversity / relations between single specie population of landrace plants which grows in larger area for centuries with minimal human interference. The location is determined by the main river where the plants grows around the river banks in the lenght of approx 200km.
I would like to sample plant material from approximately 40 locations own the river banks and comp ..read more
Biology Online Forum » Genetics
1y ago
Thanks for helping with this. Very useful and interesting ..read more
Biology Online Forum » Genetics
1y ago
Visualization of DNA sequence invented in 2015 by Polish scientist Gregory Podgorniak,
above this sequence –
GCGGCTTCCTACCTTTAGCTCCGAGTATAGTGAGGCCTAGATATGCGCGGGCAGGTAGCTACAGTGTATACATG CTCGTTCTGCGGCATGCGGATATAAATTAAGGATAATACTCAAGTGTTCCAGGGGAGCAGTCATAAAGCACAAC TTCATTATCCCTAAGCTCAGTTAATCTAAGCATGTTTAGCGCTAAGTCTCGTCTACGCGGCAAATACTTTGTAA GCGTTTCTTTAACTTGCCGCTCTCAGAAGGGGCACGGCCGTCATTATGTAACAAGAACGAGTCTCTTACTGGTT GTGCGAGTGGAATGGAGCAACGATGTACGTGTACCGGAAATTTCTAAGGTTTCCCGGCGTATCGATCAAGTCCA GGTTACCGCCTCCCGACAAGGGTATGCTCAACATCCACTGCTGCTGTCCTACGCTCCCTTGGAGACCAATCCTG CGTCATTCAAACTTCGAACATGCGCCGGCATTGTATGTTC ..read more
Biology Online Forum » Genetics
1y ago
I think potential for talent can be inherited, through genes. Whether or not the talent is recognised depends other factors like practice. i saw this answer in ms office mcqs site that is best for every person ..read more
Biology Online Forum » Genetics
1y ago
Isn’t it fascinating that the offspring of the parents, a white bovine and a brown bovine, is neither completely white nor completely brown? Instead, it is a white bovine with brown spots or a brown one with white spots (Figure 1). Have you ever wondered why this happens? This becomes all the more intriguing considering the Mendelian law of genetic inheritance wherein dominant trait is expressed.
Figure 1: Appearance of spotted cow in a cross between whole white and whole brown bovine. Full explanation of this test cross is found here: https://www.biologyonline.com/dictionary/codominance.
Wha ..read more